The Piltdown Hoax

The Piltdown Hoax

            In 1912 there was a piece of a skull found in Southeast England, specifically in the village of Piltdown. The local archaeologist, Charles Dawson, claimed that the skull appeared to be primitive and this skull seemed to be the “missing link” that people were trying to find. The “missing link” was supposed to be something that linked humans to apes, but it really did not exist. After the discovery, geologist Sir Arthur Smith Woodward joined in with Charles Dawson to keep on digging to look for more bones that summer. They ended up finding an ape-like jawbone that had human teeth which could have also been the “missing link.” Although the jawbone was a big find, it missed a crucial piece being the canine tooth. Dawson and Woodward then invited another amateur archaeologist, Priest Teilhard de Chardin, to help them find more bones. A year later, a canine tooth was found in Piltdown that matched both Woodward and Dawson’s prediction of size. Now that this canine was found, it made the Piltdown man seem like the perfect “missing link” and it silenced the doubters. Then in 1953 the Piltdown man was declared a hoax. A chemical test was done on the Piltdown man by Kenneth Oakley revealing that the Piltdown man was younger than everyone else had expected. The skull had also been stained to look older than it was along with teeth that had been filed down to size. And lastly the jaw was less than 100 years old and happened to be the jaw of a female orangutan.

            After finding the bones in Piltdown, it led people on a crazy hunt for the “missing link” between humans and apes. Everyone was so inclined to find it, they never thought of the possibility that the “missing link” did not exist. Scientists had their careers set to finding more about the Piltdown man and trying to link the Piltdown man to previous ancestors or humans and apes. This is where human faults negatively came into play. Humans can be so curious to find out more and so persistent to do so that they got lost in reality. These scientist got caught up in trying to find the “missing link” and when the Piltdown man came out as a hoax it then revealed that there really was no “missing link” between humans and apes.

            In 1953 science was developed enough to reveal that the Piltdown man was a hoax. The way scientists found this out was by chemically testing the Piltdown bones. The fluorine tests done on the bones could estimate age of the bones. The bones turned out to be significantly younger than expected and the skull had a different age than the jaw. The jaw happened to be less than 100 years old and was the jaw of a female orangutan. After looking at the teeth under a microscope it was revealed that the teeth had been filed down to a size that looked like human teeth. The fossils had also been boiled and stained to look older than they actually were, while the canine was filed down and painted.  

            It is not possible to remove the “human” factor in science because humans have the ability to reason. Not everything in science can be 100% proved based mainly on the fact that we do not have evidence for every single thing. Some things in science need to be reasoned with in order to make sense. Things like the big bang theory cannot be scientifically proven but the theory is scientifically accepted because humans have the ability to reason with the little evidence we have.

            With science and everything else, things need to be taken from credible sources or proven otherwise. It is crazy to think that most of the world seemed to believe that this Piltdown man was the “missing link” especially since it was found by an unknown amateur archaeologist. For 40 years the world believed him until someone tested Dawson. Scientists proved Dawson wrong changing so much that people claimed to believe. So when accepting information now, we should be skeptical rather than going along with everything. If scientists back in the 1900’s challenged Dawson’s findings, those 40 years of believing in the "missing link" could have been avoided.

Analogy & Homology

Homology
Surprisingly, humans and whales share a homologous trait. In the human hand and the whale fin, both species share "phalanges." For humans, the phalanges are the long bones in our hands and feet that are needed to grip things, or walk. Whales also have phalanges but in their fins, and they are also a lot longer than the phalanges in the human body. The whales use their phalanges to help them swim and move through the water. Although both humans and whales use their phalanges for movement, they are very much different as the human phalanges are much smaller than the large whale phalanges.


Analogy
Ducks and platypus both possess an analogous trait of laying eggs. Although both a platypus and a duck can lay eggs, they did not gain this trait from the same common ancestor as a platypus is a mammal and a duck is a bird. The platypus shares no other traits with birds besides laying eggs so it is a perfect example of an analogous trait.

From this image above, it appears that the closest ancestor between birds and platypus goes back to 325 Mya to a species called Amniotes. I believe that this species had to have carried the analogous trait of laying eggs because that seems like the only way that the platypus would gain the trait of laying eggs.


Sources:
http://www.bio.miami.edu/dana/160/160S13_5.html
http://www.buzzle.com/articles/analogous-structures.html

Decode My DNA Strand

GGCTATACACGTGCCAACCGAACGTAAGTGTTAGCTGAATCCGT

Assignment 1

A lot of individuals have helped shape Darwin's theory of Natural Selection but Thomas Malthus may have had the biggest influence. Thomas Malthus wrote An Essay on the Principle of Population explaining how population size is restricted by the resources available. Malthus then describes how all organisms must compete in order to survive with the limited resources. Competition plays a huge role in Darwin's theory of Natural Selection because it favors the organisms that can compete for and get the resources needed to survive. In An Essay on the Principle of Population Malthus points out that all organisms can reproduce exponentially, even to the point where the organisms cannot survive anymore. Another point in Darwin's theory of Natural Selection is that resources are limited. Malthus states that when resources are limited, the population size is also limited because of the competition that is created. This is a major point that Darwin adopted into his theory and I do not believe he could have created the theory without Malthus' influence. Although Darwin himself felt indifferent towards religion, his wife Emma Wedgwood had strong religious convictions that made Darwin second guess publishing his work. Darwin's ideas about natural selection went against his wife's religious views but after receiving a paper from Alfred Wallace he knew he had to publish his book. Darwin was afraid that Wallace's paper would take credit for the finding of the theory of natural selection so he decided that he would publish his work. In December of 1859 Darwin published On the Origin of Species. 

http://www.ucmp.berkeley.edu/history/malthus.html